circad | circRNAs associated with diseases

rno_circRNA_001168
Gene	LOC681740	Organism	Rat
Genome Locus	n/a	Build	n/a
Disease	Traumatic brain injury	ICD-10	Intracranial laceration and haemorrhage due to birth injury (P10)
DBLink	Link to database	PMID	29357736
Experimental Method
Sample Type	Neuronal Tissues	Comparison	tissue samples before and after brain injury
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward TGAGATCACTGCCAGCTTTCG Reverse TTATTCCCATGCGTCCTTTAGG	Statistics	Fold Change : Downregulated pvalue : p<0.05
Citation
Xie, BS, Wang, YQ, Lin, Y, Zhao, CC, Mao, Q, Feng, JF, Cao, JY, Gao, GY, Jiang, JY (2018). Circular RNA Expression Profiles Alter Significantly after Traumatic Brain Injury in Rats. J. Neurotrauma, 35, 14:1659-1666.